Review



rb a med12  (Cell Signaling Technology Inc)


Bioz Verified Symbol Cell Signaling Technology Inc is a verified supplier
Bioz Manufacturer Symbol Cell Signaling Technology Inc manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 94
      Buy from Supplier

    Structured Review

    Cell Signaling Technology Inc rb a med12
    Rb A Med12, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 13 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rb+a+med12/MED12+Rabbit+mAb/bio_rxiv__64898__2026__02__12__705659-206-55-56
    Average 94 stars, based on 13 article reviews
    rb a med12 - by Bioz Stars, 2026-11
    94/100 stars

    Images

    Related Articles

    other:

    Article Title: Divergent condensates tune transcriptional responses during stress
    Article Snippet: Blocking was performed using blocking buffer (BB, 2.5% normal goat serum in 1x PBS; normal goat serum, Jackson Immuno Research, 005-000-121,) for 1 h at RT.



    Similar Products

    rb a med12  (Cell Signaling Technology Inc)
    94
    Cell Signaling Technology Inc rb a med12
    Rb A Med12, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rb+a+med12/MED12+Rabbit+mAb/bio_rxiv__64898__2026__02__12__705659-206-55-56
    Average 94 stars, based on 1 article reviews
    rb a med12 - by Bioz Stars, 2026-11
    94/100 stars
    		  Buy from Supplier
    med12s-sp (5 0-acatgcatgcat gggagaacgaaaacgatgagcgg aac; underline, sphi; bold, start codon; italic, ribosome-binding site, rbs)  (Bioservice Scientific Laboratories)
    90
    Bioservice Scientific Laboratories med12s-sp (5 0-acatgcatgcat gggagaacgaaaacgatgagcgg aac; underline, sphi; bold, start codon; italic, ribosome-binding site, rbs)
    Med12s Sp (5 0 Acatgcatgcat Gggagaacgaaaacgatgagcgg Aac; Underline, Sphi; Bold, Start Codon; Italic, Ribosome Binding Site, Rbs), supplied by Bioservice Scientific Laboratories, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/rb+a+med12/med12s+sp++5+0+acatgcatgcat+gggagaacgaaaacgatgagcgg+aac++underline++sphi++bold++start+codon++italic++ribosome+binding+site++rbs+/pm16169737-67-34-19
    Average 90 stars, based on 1 article reviews
    med12s-sp (5 0-acatgcatgcat gggagaacgaaaacgatgagcgg aac; underline, sphi; bold, start codon; italic, ribosome-binding site, rbs) - by Bioz Stars, 2026-11
    90/100 stars
    		  Buy from Supplier

    Image Search Results